The carbon atom (C) is one of the most important atoms in biological molecules. Several roperties of this “atom make it suitable for life on earth. 

Which of the following statements are true? 

I. Carbon-carbon bond energy is higher than the energy of visible spectrum of light. 

ii. Carbon-nitrogen bonds can be broken by UV light spontaneously. 

iii. Each hydrogen bond in water is stronger than the carbon-carbon covalent bond. 

iv. Carbon-hydrogen bond can be broken by infra red light spontaneously. 

(a) i & ii 

(b) i & iii 

(c) ii & iv 

(d) i, ii & iv

Four types of chemical messengers (Black Dots) released from the regulator cell (R) to the target cell (T) are depicted in I, II, III and IV

Match I, II, III and IV sequentially with (i) Steroid Hormone, (ii) Pheromones, (iii) Neurohormone iv) Neurotransmitter and choose the correct option. 

(a) iv, iii, ii, i 

(b) iv, iii, i, ii 

(c) i, ii, iii, iv 

(d) iii, iv, i, ii

If a gene needs to be introduced in a plant, the expression vector has to be: 

(a) pBR322 

(b) Ti plasmid 

(c) λ phage 

(d) YAC

Sclerides are the sclerenchyma cells with very thick secondary wall deposits and provide echanical support. In which of the following plant organs one would expect to find abundant sclerides? 

(a) Underground tuberous roots. 

(b) Leaves of floating hydrophyte. 

(c) Flower petals of mesophytes. 

(d) Petioles of xerophytic plant.

A littoral gastropod will have thickest shell when it is located at the 

(a) high tide marks on a rock beach. 

(b) greatest depth in a sand beach. 

(c) low tide marks on a mud beach. 

(d) bottom of a rock pool

In principle,longest Henle’s loop should be found in the nephrons of desert dwelling mammal feeding mainly on : 

(a) succulent cactus 

(b) fleshy fruits 

(c) leathery leaves 

(d) seeds

If a tissue is consuming 50 molecules of O₂ and releasing 70 molecules of CO₂, then the substrate being utilized in cellular respiration is : 

(a) glucose 

(b) fatty acid 

(c) amino acid 

(d) organic acid

Which of the following animals has blood as circulating medium? 

(a) Cockroach 

(b) Mussel 

(c) Leech 

(d) Planaria

Despite the lack of pressure, blood moves towards the heart in veins due to the 

(a) wider bore. 

(b) suction created due to pumping by heart. 

(c) narrow bores of efferent capillaries. 

(d) presence of valves preventing back flow.

Following sequence of RNA, when translated will form a protein molecule of _____ amino acids.

5′ GCUCGCAUGCCAGAUGUCUUCGUCCUUUAGUUUAUUAGA 3′ 

(a) 3 

(b) 7 

(c) 6 

(d) 9