If the coding sequence in a transcription unit is written as follows:5 – InterviewSolution

InterviewSolution

1.

If the coding sequence in a transcription unit is written as follows:5’ TGCATGCATGCATGCATGCATGCATGC 3’ Write down the sequence of mRNA.

Answer»

mRNA sequence is

3’ACGUACGUACGUUCGUACGUACGUACG5’

Discussion

No Comment Found

Related InterviewSolutions

In Hershey – Chase experiment, the DNA of T phase was made radioactive by using ___________ (a) 32P (b) 32S (c) 35P (d) 32S
Whose experiment finally provided convincing evidence that DNA is the genetic material? (a) Griffith experiment (b) Avery, Macleod and McCarty’s experiment (c) Hershey-Chase experiment (d) Urey-Miller’s experiment
Explain the properties of DNA that makes it an ideal genetic material.
What are the properties that a molecule must possess to act as genetic material?
Assertion (A) : Genophore is noticed in prokaryotes. Reason (R) : Bacteria possess circular DNA without chromatin organisation. (a) Both A and R are correct (b) A is correct R is incorrect (c) R explains A (d) A is incorrect R is correct
Retroviruses possess ________ as genetic material.
What is capping and tailing?
If the length of E. coli DNA is 1.36 mm, the number of base pairs is ___________(a) 0.36 × 106 m (b) 4 × 106 m (c) 0.34 × 10-9 nm (d) 4 × 10-9 m
In E.coli, three enzymes 0- galactosidase, permease and transacetylase are produced in the presence of lactose. Explain why the enzymes are not synthesized in the absence of lactose.
Semi-conservative model of replication was proved by __________ (a) Hershey and Chase (b) Griffith (c) Meselson and Stahl (d) Macleod and McCarty