18288 + Interview Questions in Biology Page 140 InterviewSolution

6951.	Chlamydomonas reproduces by
Answer» Chlamydomonas reproduces by

Discussion

6952.	Why vincristine and vinblastin don not affect our normal body cells?
Answer» Why vincristine and vinblastin don not affect our normal body cells?

Discussion

6953.	The enzyme required for transcription is:
Answer» The enzyme required for transcription is:

Discussion

6954.	Identify the enzymes responsible for the following processes in the digestion of carbohydrates :
Answer» Identify the enzymes responsible for the following processes in the digestion of carbohydrates :

6954.

Identify the enzymes responsible for the following processes in the digestion of carbohydrates :

Answer»

Identify the enzymes responsible for the following processes in the digestion of carbohydrates :

Discussion

6955.	Why is the offspring formed by asexual reproduction referred to as clone?
Answer» Why is the offspring formed by asexual reproduction referred to as clone?

Discussion

6956.	Where is the seminal vesicle in cockroach located with respect tothe mushroom gland ?
Answer» Where is the seminal vesicle in cockroach located with respect tothe mushroom gland ?

Discussion

6957.	'Peat' is an important source of domestic fuel in several countries. How is 'peat' formed in nature?
Answer» 'Peat' is an important source of domestic fuel in several countries. How is 'peat' formed in nature?

Discussion

6958.	Are there 8 proteins in the gap junctions between 2 epithelial cells?
Answer» Are there 8 proteins in the gap junctions between 2 epithelial cells?

Discussion

6959.	The part of antibody molecule which acts asa binding site for specific related antigen is
Answer» The part of antibody molecule which acts asa binding site for specific related antigen is

Discussion

6960.	Fresh milk has a pH of 6.When it changes into curd (yogurt), will its pH value increase or decrease? Why? [2 MARKS]
Answer» Fresh milk has a pH of 6.When it changes into curd (yogurt), will its pH value increase or decrease? Why? [2 MARKS]

Discussion

6961.	An exception among chlorophyllous bryophytes is _________
Answer» An exception among chlorophyllous bryophytes is _________

Discussion

6962.	What is surface antigens
Answer» What is surface antigens

Discussion

6963.	Most fishes and amphibians
Answer» Most fishes and amphibians

Discussion

6964.	If the town with a population of 500 individuals sees an increase by 80 individuals and has 20 individuals dying, what would be the growth rate of the population?
Answer» If the town with a population of 500 individuals sees an increase by 80 individuals and has 20 individuals dying, what would be the growth rate of the population?

Discussion

6965.	In the given figure 10.2, mark the positions of the endocrine glands which release the hormones that:(a) controls the release of sex hormones.(b) is responsible for the secondary sexual characters in boys.(c) prevents diabetes.(d) maintains the correct salt balance in the blood.
Answer» In the given figure 10.2, mark the positions of the endocrine glands which release the hormones that: (a) controls the release of sex hormones. (b) is responsible for the secondary sexual characters in boys. (c) prevents diabetes. (d) maintains the correct salt balance in the blood.

Discussion

6966.	Write about the different types of breeding of sheep and also comment about the origin of the respective breed?
Answer» Write about the different types of breeding of sheep and also comment about the origin of the respective breed?

Discussion

6967.	The given figure represents the process of transcription in bacteria.
Answer» The given figure represents the process of transcription in bacteria.

Discussion

6968.	Nucellar embryo is Amphimictic haploid Amphimictic diploid Apomictic haploid Apomictic diploid Explain.....
Answer» Nucellar embryo is Amphimictic haploid Amphimictic diploid Apomictic haploid Apomictic diploid Explain.....

6968.

Nucellar embryo is Amphimictic haploid Amphimictic diploid Apomictic haploid Apomictic diploid Explain.....

Answer»

Nucellar embryo is

Amphimictic haploid

Amphimictic diploid

Apomictic haploid

Apomictic diploid

Explain.....

Discussion

6969.	In malignant tumors, the cells proliferate, grow rapidly and move to other parts of the body to form new tumors. This stage of disease is called
Answer» In malignant tumors, the cells proliferate, grow rapidly and move to other parts of the body to form new tumors. This stage of disease is called

Discussion

6970.	Animals that reproduce by laying eggs are
Answer» Animals that reproduce by laying eggs are

Discussion

6971.	Structure of double stranded DNA and single stranded DNA
Answer» Structure of double stranded DNA and single stranded DNA

Discussion

6972.	Of the following taxonomic categories which is the most inclusive. A) order B) class C) genus D) family.
Answer» Of the following taxonomic categories which is the most inclusive. A) order B) class C) genus D) family.

Discussion

6973.	What is ph of a substance?
Answer» What is ph of a substance?

Discussion

6974.	In the above cross, what is the ratio between homozygous plants and heterozygous plants of F2 progeny?
Answer» In the above cross, what is the ratio between homozygous plants and heterozygous plants of $F_{2}$ progeny?

Discussion

6975.	ntHenrys law constant of co2 in water at 298k is 5/3bar.if pressure of co2is 0.01 bar,find its mole fraction?n
Answer» ntHenrys law constant of co2 in water at 298k is 5/3bar.if pressure of co2is 0.01 bar,find its mole fraction?n

Discussion

6976.	The vectorless gene transfer include
Answer» The vectorless gene transfer include

Discussion

6977.	Differentiate between the followings: (a) Repetitive DNA and Satellite DNA (b) mRNA and tRNA (c) Template strand and Coding strand
Answer» Differentiate between the followings: (a) Repetitive DNA and Satellite DNA (b) mRNA and tRNA (c) Template strand and Coding strand

6977.

Differentiate between the followings: (a) Repetitive DNA and Satellite DNA (b) mRNA and tRNA (c) Template strand and Coding strand

Answer»

Differentiate
between the followings:

(a)
Repetitive DNA and Satellite DNA

(b)
mRNA and tRNA

(c)
Template strand and Coding strand

Discussion

6978.	Which of the following is the upper part of the womb?
Answer» Which of the following is the upper part of the womb?

Discussion

6979.	what is the structure of haemoglobin? what is pneumotaxis centre(in respiratory system)?
Answer» what is the structure of haemoglobin? what is pneumotaxis centre(in respiratory system)?

Discussion

6980.	why focal length of concave lens is negativ
Answer» why focal length of concave lens is negativ

Discussion

6981.	The figure shows a diagrammatic view of the human respiratory system with labels. Select the option that gives the incorrect identification and main function or characteristic.
Answer» The figure shows a diagrammatic view of the human respiratory system with labels. Select the option that gives the incorrect identification and main function or characteristic.

6981.

The figure shows a diagrammatic view of the human respiratory system with labels. Select the option that gives the incorrect identification and main function or characteristic.

Answer»

The figure shows a diagrammatic view of the human respiratory system with labels. Select the option that gives the incorrect identification and main function or characteristic.

Discussion

6982.	How many mitotic and meiotic divisions are required to produce a seed starting from microspore Mother cell and megaspore mother cell
Answer» How many mitotic and meiotic divisions are required to produce a seed starting from microspore Mother cell and megaspore mother cell

Discussion

6983.	F= 9-4x. Is it SHM or not. Give explanation.
Answer» F= 9-4x. Is it SHM or not. Give explanation.

Discussion

6984.	define axo-dendritic,axo-somatic and axo-axonic
Answer» define axo-dendritic,axo-somatic and axo-axonic

Discussion

6985.	Read the following paragraph and identify the disease.Today, her child became one and half year old. However, that child does not seem to be healthy and happy. It was continuously crying and gradually becoming weak. It has shortness of breath. Its nails have become blue.
Answer» Read the following paragraph and identify the disease. Today, her child became one and half year old. However, that child does not seem to be healthy and happy. It was continuously crying and gradually becoming weak. It has shortness of breath. Its nails have become blue.

Discussion

6986.	What is insemination?
Answer» What is insemination?

Discussion

6987.	Are the calcium, rubidium and cesium making their nitride?
Answer» Are the calcium, rubidium and cesium making their nitride?

Discussion

6988.	Why should a highly variable external environment bother organisms after all?
Answer» Why should a highly variable external environment bother organisms after all?

Discussion

6989.	If the sequence of the coding strand in a transcription unit is written as follows 5' - ATGCATGCATGCATGCATGCATGCATGC - 3' Write down the sequence of mRNA.
Answer» If the sequence of the coding strand in a transcription unit is written as follows 5' - ATGCATGCATGCATGCATGCATGCATGC - 3' Write down the sequence of mRNA.

Discussion

6990.	Assertion (A): Higher plants can not utilize nitrogen that is present in the form of N2 in air.Reason (R): In higher plants, the nitrogenase enzyme is absent.
Answer» Assertion (A): Higher plants can not utilize nitrogen that is present in the form of $N_{2}$ in air. Reason (R): In higher plants, the nitrogenase enzyme is absent.

6990.

Assertion (A): Higher plants can not utilize nitrogen that is present in the form of N2 in air.Reason (R): In higher plants, the nitrogenase enzyme is absent.

Answer»

Assertion (A): Higher plants can not utilize nitrogen that is present in the form of $N_{2}$ in air.

Reason (R): In higher plants, the nitrogenase enzyme is absent.

Discussion

6991.	The lower surface of leaf will have more number of stomata in a:
Answer» The lower surface of leaf will have more number of stomata in a:

Discussion

6992.	Triticale is a somatic hybrid formed between
Answer» Triticale is a somatic hybrid formed between

Discussion

6993.	Fill in the blanks:(a) Humansreproduce __________. (asexually/sexually)(b) Humansare__________. (oviparous/viviparous/ovoviviparous)(c) Fertilizationis __________ in humans. (external/internal)(d) Male andfemale gametes are __________. (diploid/haploid)(e) Zygote is__________. (diploid/haploid)(f) The process of release of the ovum from a mature follicleis called__________.(g) Ovulationis induced by a hormone called the __________. (h) The fusionof the male and the female gametes is called __________.(i) Fertilizationtakes place in the __________.(j) The zygotedivides to form __________, which is implanted in uterus.(k) The structure which provides vascular connection betweenthe fetus and uterus is called __________.
Answer» Fill in the blanks: (a) Humans reproduce __________. (asexually/sexually) (b) Humans are__________. (oviparous/viviparous/ovoviviparous) (c) Fertilization is __________ in humans. (external/internal) (d) Male and female gametes are __________. (diploid/haploid) (e) Zygote is __________. (diploid/haploid) (f) The process of release of the ovum from a mature follicle is called__________. (g) Ovulation is induced by a hormone called the __________. (h) The fusion of the male and the female gametes is called __________. (i) Fertilization takes place in the __________. (j) The zygote divides to form __________, which is implanted in uterus. (k) The structure which provides vascular connection between the fetus and uterus is called __________.

6993.

Fill in the blanks:(a) Humansreproduce . (asexually/sexually)(b) Humansare. (oviparous/viviparous/ovoviviparous)(c) Fertilizationis in humans. (external/internal)(d) Male andfemale gametes are . (diploid/haploid)(e) Zygote is. (diploid/haploid)(f) The process of release of the ovum from a mature follicleis called.(g) Ovulationis induced by a hormone called the . (h) The fusionof the male and the female gametes is called .(i) Fertilizationtakes place in the .(j) The zygotedivides to form , which is implanted in uterus.(k) The structure which provides vascular connection betweenthe fetus and uterus is called __.

Answer»

Fill in the blanks:

(a) Humans
reproduce __________. (asexually/sexually)

(b) Humans
are__________. (oviparous/viviparous/ovoviviparous)

(c) Fertilization
is __________ in humans. (external/internal)

(d) Male and
female gametes are __________. (diploid/haploid)

(e) Zygote is
__________. (diploid/haploid)

(f) The process of release of the ovum from a mature follicle
is called__________.

(g) Ovulation
is induced by a hormone called the __________.

(h) The fusion
of the male and the female gametes is called __________.

(i) Fertilization
takes place in the __________.

(j) The zygote
divides to form __________, which is implanted in uterus.

(k) The structure which provides vascular connection between
the fetus and uterus is called __________.

Discussion

6994.	What is Endomitosis?
Answer» What is Endomitosis?

Discussion

6995.	Question 41 Write brief note on the following Synaptonemal complex Metaphase plate
Answer» Question 41 Write brief note on the following Synaptonemal complex Metaphase plate

6995.

Question 41 Write brief note on the following Synaptonemal complex Metaphase plate

Answer»

Question 41
Write brief note on the following
Synaptonemal complex

Metaphase plate

Discussion

6996.	29.Explain the Posse-Germain's Identity
Answer» 29.Explain the Posse-Germain's Identity

Discussion

6997.	Regarding the assertion and reason; choose the correct option. Assertion (A): In case of acute constipation, purgatives containing magnesium salts are usually used to alleviate it Reason (R): The osmotic effect of Mg2+ in the intestinal lumen prevents water from being reabsorbed from the intestine. Mg2+ increases the solute concentration in the intestinal lumen because Mg2+ is absorbed very slowly
Answer» Regarding the assertion and reason; choose the correct option. Assertion (A): In case of acute constipation, purgatives containing magnesium salts are usually used to alleviate it Reason (R): The osmotic effect of Mg²⁺ in the intestinal lumen prevents water from being reabsorbed from the intestine. Mg²⁺ increases the solute concentration in the intestinal lumen because Mg²⁺ is absorbed very slowly

6997.

Regarding the assertion and reason; choose the correct option. Assertion (A): In case of acute constipation, purgatives containing magnesium salts are usually used to alleviate it Reason (R): The osmotic effect of Mg2+ in the intestinal lumen prevents water from being reabsorbed from the intestine. Mg2+ increases the solute concentration in the intestinal lumen because Mg2+ is absorbed very slowly

Answer»

Regarding the assertion and reason; choose the correct option.

Assertion (A): In case of acute constipation, purgatives containing magnesium salts are usually used to alleviate it

Reason (R): The osmotic effect of Mg²⁺ in the intestinal lumen prevents water from being reabsorbed from the intestine. Mg²⁺ increases the solute concentration in the intestinal lumen because Mg²⁺ is absorbed very slowly

Discussion

6998.	Mention two objectives of setting up GEAC by our Government. [1]
Answer» Mention two objectives of setting up GEAC by our Government. [1]

Discussion

6999.	The weight of a fruit is determined by three pairs if polygenes.following cross AABBCC (dark colour) , in F2 generation what proportion of the progeny is likely to resemble either parent? 1.none 2.less than 5 percent 3.one third 4.half
Answer» The weight of a fruit is determined by three pairs if polygenes.following cross AABBCC (dark colour) , in F2 generation what proportion of the progeny is likely to resemble either parent? 1.none 2.less than 5 percent 3.one third 4.half

Discussion

7000.	Chassez l'intrus.1. jupe, cravate, manteau, chemise.2. fromage, confiture, beurre, pomme.3. poulet, jambon, haricot vert, viande.4. grand, jolie, méchant, amusant.
Answer» Chassez l'intrus. 1. jupe, cravate, manteau, chemise. 2. fromage, confiture, beurre, pomme. 3. poulet, jambon, haricot vert, viande. 4. grand, jolie, méchant, amusant.

Discussion

Explore topic-wise InterviewSolutions in .

Chlamydomonas reproduces by

Why vincristine and vinblastin don not affect our normal body cells?

The enzyme required for transcription is:

Identify the enzymes responsible for the following processes in the digestion of carbohydrates :

Why is the offspring formed by asexual reproduction referred to as clone?

Where is the seminal vesicle in cockroach located with respect tothe mushroom gland ?

'Peat' is an important source of domestic fuel in several countries. How is 'peat' formed in nature?

Are there 8 proteins in the gap junctions between 2 epithelial cells?

The part of antibody molecule which acts asa binding site for specific related antigen is

Fresh milk has a pH of 6.When it changes into curd (yogurt), will its pH value increase or decrease? Why? [2 MARKS]

An exception among chlorophyllous bryophytes is _________

What is surface antigens

Most fishes and amphibians

If the town with a population of 500 individuals sees an increase by 80 individuals and has 20 individuals dying, what would be the growth rate of the population?

In the given figure 10.2, mark the positions of the endocrine glands which release the hormones that:(a) controls the release of sex hormones.(b) is responsible for the secondary sexual characters in boys.(c) prevents diabetes.(d) maintains the correct salt balance in the blood.

Write about the different types of breeding of sheep and also comment about the origin of the respective breed?

The given figure represents the process of transcription in bacteria.

Nucellar embryo is Amphimictic haploid Amphimictic diploid Apomictic haploid Apomictic diploid Explain.....

In malignant tumors, the cells proliferate, grow rapidly and move to other parts of the body to form new tumors. This stage of disease is called

Animals that reproduce by laying eggs are

Structure of double stranded DNA and single stranded DNA

Of the following taxonomic categories which is the most inclusive. A) order B) class C) genus D) family.

What is ph of a substance?

In the above cross, what is the ratio between homozygous plants and heterozygous plants of F2 progeny?

ntHenrys law constant of co2 in water at 298k is 5/3bar.if pressure of co2is 0.01 bar,find its mole fraction?n

The vectorless gene transfer include

Differentiate between the followings: (a) Repetitive DNA and Satellite DNA (b) mRNA and tRNA (c) Template strand and Coding strand

Which of the following is the upper part of the womb?

what is the structure of haemoglobin? what is pneumotaxis centre(in respiratory system)?

why focal length of concave lens is negativ

The figure shows a diagrammatic view of the human respiratory system with labels. Select the option that gives the incorrect identification and main function or characteristic.

How many mitotic and meiotic divisions are required to produce a seed starting from microspore Mother cell and megaspore mother cell

F= 9-4x. Is it SHM or not. Give explanation.

define axo-dendritic,axo-somatic and axo-axonic

Read the following paragraph and identify the disease.Today, her child became one and half year old. However, that child does not seem to be healthy and happy. It was continuously crying and gradually becoming weak. It has shortness of breath. Its nails have become blue.

What is insemination?

Are the calcium, rubidium and cesium making their nitride?

Why should a highly variable external environment bother organisms after all?

If the sequence of the coding strand in a transcription unit is written as follows 5' - ATGCATGCATGCATGCATGCATGCATGC - 3' Write down the sequence of mRNA.

Assertion (A): Higher plants can not utilize nitrogen that is present in the form of N2 in air.Reason (R): In higher plants, the nitrogenase enzyme is absent.

The lower surface of leaf will have more number of stomata in a:

Triticale is a somatic hybrid formed between

What is Endomitosis?

Question 41 Write brief note on the following Synaptonemal complex Metaphase plate

29.Explain the Posse-Germain's Identity

Mention two objectives of setting up GEAC by our Government. [1]

The weight of a fruit is determined by three pairs if polygenes.following cross AABBCC (dark colour) , in F2 generation what proportion of the progeny is likely to resemble either parent? 1.none 2.less than 5 percent 3.one third 4.half

Chassez l'intrus.1. jupe, cravate, manteau, chemise.2. fromage, confiture, beurre, pomme.3. poulet, jambon, haricot vert, viande.4. grand, jolie, méchant, amusant.