Explore topic-wise InterviewSolutions in .

1. Helicase 

2. DNA ligase 

3. DNA polymerase 

4. Nuclease

At the point of origin of replication, the helicases and topoisomerases (DNA gyrase) unwind and pull apart the strands, forming a YShaped structure called the replication fork. There are two replication forks at each origin.

The discontinuously synthesized fragments of the lagging strand are called the Okazaki fragments are joined by the enzyme DNA ligase.

Correct Answer is : DNA ligase

Correct Answer is: Pribnow box

Initiation of translation in E. coli begins with the formation of an initiation complex, consisting of the 30S subunits of the ribosome, a messenger RNA and the charged N-formyl methionine tRNA (f^met -1 RNA f^met ), three proteinaceous initiation factors (IF 1, IF2, IF3), GTP (Guaniner Tri Phosphate) and Mg²⁺ .

Three codons terminate translation process. They are UAA, UAG and UGA.

Since hnRNA contains both coding sequences (exons) and non-coding sequences (introns) it has to undergo splicing to remove introns.

1. Tyrosine – UAU, UAC 

2. Histidine – CAU, CAC

UnTranslated Regions (UTR)

1. Forensic analysis 

2. Pedigree analysis 

3. Conservation of wild life 

4. Anthropological studies

(b) Electrophoresis

Frederick Sanger

The complementary strand has ATCGTACTA.

mRNA sequence is

3’ACGUACGUACGUUCGUACGUACGUACG5’

The international human genome project was launched in the year 1990. It was a mega project and took 13 years to complete. The human genome is about 25 times larger than the genome of any organism sequenced to date and is the first vertebrate genome to be completed. Human genome is said to have approximately 3 >109 bp. HGP was closely associated with the rapid development of a new area in biology called bioinformatics.

(b) Alec Jeffreys

The cluster of genes with related functions is called operon. 

E.g: lac operon in E.coli.

1. ETS : Expressed Sequence Tags 

2. YAC : Yeast Artificial Chromosomes

(d) 3.1 billion

In prokaryotes, there are three major types of RNAs: mRNA, tRNA, and rRNA. All three \ RNAs are needed to synthesize a protein in a cell. The mRNA provides the template, tRNA brings amino acids and reads the genetic code, and rRNAs play structural and catalytic role during translation.

(b) C U C A A U C G U C C G

Both purines and pyrimidines are nitrogen bases. The purine bases Adenine and Guanine have double carbon – nitrogen ring, whereas cytosine and thymine bases have single carbon nitrogen ring.

1. i gene – repressor protein 

2. lac Z gene – fS-galactosidase

3. Lac Y gene – Permease 

4. lac a gene – transacetylase

Correct Answer is: (b) 3

One of the enzyme synthesized by lac operon is permease which is involved in the transport of lactose into the cells. If the lac operon gets inactivated, permease is not synthesized hence lactose cannot enter the cell. Lactose acts as a inducer, binding to the repressor protein and switch on the operator to initiate gene expression.

(c) Unwinding of DNA strand is carried out by topoisomerase

Scientists have identified about 1.4 million locations, where single base DNA differences (SNPs – Single nucleotide polymorphism – pronounced as ‘snips’) occur in humans. Identification of ‘SNIPS’ is helpful in finding chromosomal locations for disease associated sequences and tracing human history.

Adenine, Guanine, Cytosine and Uracil.

Jacob and Monod

Francis Crick proposed the Central dogma in molecular biology which states that genetic information flows as follows:

(c) Wilkins and Franklin

1. Nucleoside: Nucleoside subunit is composed of nitrogenous bases linked to a pentose sugar molecule. 

2. Nucleotide: Nucleotide subunit is composed of nitrogenous bases, a pentose sugar and a phosphate group.

George Beadle and Edward Tatum proposed One gene – One enzyme hypothesis which states that one gene controls the production of one enzyme.

(d) Splicing – Joining of exons with introns