InterviewSolution
This section includes InterviewSolutions, each offering curated multiple-choice questions to sharpen your knowledge and support exam preparation. Choose a topic below to get started.
| 2951. | 
                                    Friends please tell me this please friends  | 
                            
| Answer» | |
| 2952. | 
                                    Kon kon rehne se bach gya waise mein abhi single huun (●__●) | 
                            
| 
                                   Answer»  Answer: KINDLY don't ask such questions here. moderators will be LOOKING into this and DELETING your ACCOUNT  | 
                            |
| 2953. | 
                                    Describe with diagram the nitrogen cycle | 
                            
| 
                                   Answer»  Answer: The nitrogen cycle is the biogeochemical cycle by which nitrogen is converted into multiple CHEMICAL forms as it circulates AMONG atmosphere, TERRESTRIAL, and MARINE ECOSYSTEMS. ... Important processes in the nitrogen cycle include fixation, ammonification, nitrification, and denitrification. Explanation: please mark as brain list answer  | 
                            |
| 2954. | 
                                    Sets of reproductive terms are given below. Choose the set that has an incorrect combination. *(a) Sperm, testis, sperm duct, penis(b) Vagina, egg, oviduct, uterus(c) Sperm, oviduct, egg, uterus(d) Ovulation, egg, oviduct, uterus | 
                            
| 
                                   Answer»  Answer:  | 
                            |
| 2955. | 
                                    Energy-producing reaction in organisms.GIVE ONE WORD ANSWER | 
                            
| 
                                   Answer»  Answer: Organisms INGEST LARGE molecules, like carbohydrates, proteins, and fats, and convert them into smaller molecules like carbon dioxide and WATER. This process is called cellular respiration, a FORM of catabolism, and makes energy AVAILABLE for the cell to use. Explanation: hope it's helps you  | 
                            |
| 2956. | 
                                    2. These are biconcave, disc-shaped cells of the blood. a.WBCsb. RBCsc. plateletsd. none of these | 
                            
| Answer» | |
| 2957. | 
                                    Shubhamraj07686 mera question dekho isse phele wala or answer bta do ☺️☺️♥️please | 
                            
| Answer» | |
| 2958. | 
                                    How is the sex of a baby is determined? Explain? | 
                            
| 
                                   Answer»  Don't POST IRRELEVANT questions Explanation:  | 
                            |
| 2959. | 
                                    1. 1.0 + 0.83 = __________ .2. The nearest whole number of 26.01 is __________ 3. 17.4 + 23.435 = ______ 4. Subtract 6.567 from 9.231 is _______5. The difference of two decimals is 86.58 and one decimal is 42.31.Then the other One is _______6. Round 61.00203 upto 3 decimal places is ________ 7. 30.9 + 52.73 = ______ .8. Round 19.99 upto 1 decimal places is _________ 9. Sum of two decimals is 4.78 . If one decimal 3.21, then the other one is _________ .10. Subtract 3.235 from 7 11. Round 76.882 upto 2 decimal places 12. Add. 25.67 and 33.856 is _______13. 81.96 + 12.48 = _____ .14. 12.7 – 3.09 = _______ .15. 0.51 + 0.25 = ________ .16. Subtract 8.12 from 10 is ________ 17 . 0.46 – 0.13 = ________ . 18. Round 910.546 upto 1 decimal places is __________ 19. The nearest whole number of 1.23 is _______________ 20. 7.0 – 2.83 = ________ . 21.3.16 × 0.23 = ______ 22. 5.6 ÷ 0.5 = _________ 23) A frog jumps 5.3 cm in one jump. The distance travelled by the frog in 10 jumps is _________ cm 24. 93.8 ÷ 1000 = ________ . 25. 100.01 × 0.01 = ________ . 26. 2.01 ÷ 0.03 = ______ 27. A printer can print 15 pages per minute. Then how many pages can he print in 4.6 minutes is _________28. 0.83 ÷ 10 = ________ 29. 1.5 × 4 = _________ . 30. The product of two numbers is 40.376. One number is 14.42. Then the other number is _________ . 31. 2.08 × 10 = ___________32. 0.05 ÷ 0.5 = _________ | 
                            
| 
                                   Answer»  sjfsffajhaarehrssfdjsjsjdkdkldkyd  | 
                            |
| 2960. | 
                                    Shubhamraj07686 ☺️♥️, Main mumbai main theri hu tum kaha rhete ho ?☺️♥️ | 
                            
| 
                                   Answer»  Answer:  | 
                            |
| 2961. | 
                                    Earth is said to be a unique planet.why? | 
                            
| 
                                   Answer»  because it have atmosphere, air &WATER and none other than earth have atmosphere  | 
                            |
| 2962. | 
                                    Litamin C lodine Vitamin B Vitamin B12. find odd  | 
                            
| 
                                   Answer»  Explanation: thank u!  | 
                            |
| 2964. | 
                                    eating potato chips and burgers regulary during the recess at school.are they healthy eating habits? reasons? | 
                            
| 
                                   Answer»  Answer: HOPE IT IS USEFUL Explanation: Answer. No. They are not healthy eating habits because POTATO chips and burgers have very LITTLE NUTRITIONAL value.  | 
                            |
| 2965. | 
                                    What is the meaning of menstruation?  | 
                            
| 
                                   Answer»  Answer: Another word for menstruation is "period." A period is the 2 to 7 DAYS that a girl or woman has her menstrual flow, which is when blood and tissue leave her body through her VAGINA.  | 
                            |
| 2966. | 
                                    Any two food preservativies | 
                            
                                   Answer» αnswєr⬤
 hσpє ít hєlps чσu  | 
                            |
| 2967. | 
                                    Main abhi soup pi rhi hu kyuki mujhe corona hua tha to maa mujhe kabhi kada de rhi hai kabhi soup  | 
                            
| 
                                   Answer»  Answer:  | 
                            |
| 2968. | 
                                    Find the odd one out also give reasons for it :plastids , mitochondria , ribosomes , Golgi apparatus | 
                            
| Answer» | |
| 2969. | 
                                    Find the odd one out also give reasons for it :apical meristems , intercalary meristem , permanent tissue lateral meristem.  | 
                            
| 
                                   Answer»  Explanation:Because others are Types of Meristematic Tissue  | 
                            |
| 2970. | 
                                    Carrier of malaria-causing protozoan is__________________________ | 
                            
| 
                                   Answer»  Answer: PLASMODIUM protozoan is responsible for malaria . FEMALE anopheles mosquito is the CARRIER of this protozoan Explanation: please Mark me as brainliest  | 
                            |
| 2972. | 
                                    The process by which amount of nitrogen remains the same in the atmosphere is known as | 
                            
| 
                                   Answer» NITROGEN Fixation Hope it HELPS:)  | 
                            |
| 2973. | 
                                    Scenes or pictures of an event shown on television are ________. | 
                            
| 
                                   Answer»  advertisement Explanation: PLEASE MARK as BRAINLIEST  | 
                            |
| 2974. | 
                                    We can see non luminous object object when light | 
                            
| 
                                   Answer»  Answer: We know that a non-luminous object is one that does not emit its own LIGHT, although it can still reflect light from other sources. So, we can see a non-luminous object, when light is REFLECTED from the object towards our EYES.  | 
                            |
| 2975. | 
                                    An object vibrating at 50 hertz.what is it's time period? | 
                            
| 
                                   Answer»  Answer: 0.02 Explanation: therefore time period = 1/50=0.02 hope it HELPS !!!  | 
                            |
| 2976. | 
                                    Answer the question given in the pic plz | 
                            
| 
                                   Answer»  a. Adrenaline HORMONE is SECRETED during the TIME of stress or emergency by the adrenal medulla. So, it is also called an emergency hormone. b. Pituitary gland controls the function of many of the other endocrine GLANDS. So, it is also called a MASTER gland.  | 
                            |
| 2977. | 
                                    An electroscope is a device which is used to find if an object is | 
                            
| 
                                   Answer»  Answer: The ELECTROSCOPE is an early scientific instrument USED to DETECT the presence of electric charge on a body. It detects charge by the MOVEMENT of a test object due to the Coulomb electrostatic force on it. The amount of charge on an object is PROPORTIONAL to its voltage.  | 
                            |
| 2978. | 
                                    What is ecosystem ?????  | 
                            
| 
                                   Answer»  Answer: An ecosystem is a geographic area where plants, animals, and other organisms, as well as weather and LANDSCAPE, work together to FORM a bubble of LIFE. Ecosystems contain biotic or LIVING, PARTS, as well as abiotic factors, or nonliving parts. ... Ecosystems can be very large or very small.  | 
                            |
| 2980. | 
                                    Find odd one out : Skeletal muscle, Spindle shaped muscle, Cardiac muscle, Neuron  | 
                            
| Answer» | |
| 2981. | 
                                    An increased sencitivity to an allergen causing dilation of blood vessels | 
                            
| 
                                   Answer»  Answer When blood vessels dilate, the flow of blood is increased due to a DECREASE in vascular RESISTANCE and increase in cardiac output. Therefore, DILATION of arterial blood vessels decreases blood pressure. The response may be intrinsic or extrinsic  | 
                            |
| 2982. | 
                                    Find odd one out : Areolar tissue, Tendons, Adipose tissue, Cartilage | 
                            
| 
                                   Answer»  Explanation:  | 
                            |
| 2983. | 
                                    Find odd one out: Cyton, Axon, Lacunae, Dendron  | 
                            
                                   Answer» Lacunaehope you UNDERSTAND the ANSWER | 
                            |
| 2984. | 
                                    Find odd one out : Stomata, Lenticels, Oxygen, Pneumatophores | 
                            
| 
                                   Answer»  Oxygen Explanation:  | 
                            |
| 2985. | 
                                    Find odd one out : Crow, Snakes, Turtles, Crocodiles | 
                            
| 
                                   Answer»  ☞ ̄ᴥ ̄☞ CROW . Because all of the other are AMPHIBIANS but crow FALLS under Aves. HOPE IT HELPS ❣️。.゚+ ⟵(。・ω・)  | 
                            |
| 2986. | 
                                    Find odd one out : Sea horses, Electric ray, Sharks, Toads  | 
                            
| 
                                   Answer»  Answer: ETERIC ray Explanation: MUJHE brainliest mark KAR aur follow kar itni mehnat SE answer deta hu  | 
                            |
| 2987. | 
                                    Find odd one out : Oysters, Squids, Octopus, Sea urchin  | 
                            
| 
                                   Answer»  SQUIDS will be the answer MAKE me SA BRAINLIEST  | 
                            |
| 2988. | 
                                    How canyou keep your things safe from fungi | 
                            
| 
                                   Answer»  by keeping them is CLEAN PLACE,and by AVOIDING moist AIR !!!!  | 
                            |
| 2989. | 
                                    Annelida move with special structure called ________.  | 
                            
                                   Answer» ANNELIDA MOVE with their special STRUCTURE called PARAPODIA or setae | 
                            |
| 2990. | 
                                    Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.Use your special enzyme to cut each sequence at the forward-slash marks (/). (You can do this by putting spaces after each slash mark.)Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.Repeat step 1 with the DNA samples for Suspects B and C.Suspect ATCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGASuspect BTCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGASuspect CTTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGAProbeAGGTQUESTIONSWhich suspect most likely committed the robbery?How do you know? | 
                            
| 
                                   Answer»  Answer: by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard ATTEMPTING to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security TAPES led POLICE to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair SAMPLES from the hat recovered by the security guard, the crime lab did a Southern Blot TEST. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.  | 
                            |
| 2991. | 
                                    ╥﹏╥╥﹏╥╥﹏╥╥﹏╥╥﹏╥╥﹏╥last ha  | 
                            
| 
                                   Answer»  Explanation: ANSWER is b 560 Rupees  | 
                            |
| 2992. | 
                                    24. India is located in_____and_____hemispheres, | 
                            
| 
                                   Answer»  hemispheres, Explanation:  | 
                            |
| 2994. | 
                                    Parenchyma cells with chloroplasts form | 
                            
| 
                                   Answer»  Parenchyma makes up the chloroplast-laden MESOPHYLL (internal LAYERS) of leaves and the cortex (outer layers) and pith (innermost layers) of stems and ROOTS; it ALSO forms the soft tissues of fruits. Explanation: HoPe It HLp'S ÙhH☺ ☺ÀpPý ßĺàp ĎàÝ('° ---- °') ☺ PLS FLW ME PLS ☹PLS(* - *) ÞhÀñĶß =ÞhÀñĶß☺ ❣ॐ जय महाकाल ❣ ✌ÌTŹ ÀbÙsiÑģ QùÈèÑ✌  | 
                            |
| 2995. | 
                                    The process of breakdown of simple sugar to release energy | 
                            
| 
                                   Answer»  Answer: The PROCESS of BREAKDOWN of simple SUGAR to release energy is cellular respiration.hope it HELPS you DEAR .... | 
                            |
| 2996. | 
                                    रथस्य शब्दे क: विभक्ति अस्ति ? | 
                            
| 
                                   Answer»  क्या मतलब है इसका , समझ में नहीं आया कि आपका क्या मतलब है Explanation:  | 
                            |
| 2997. | 
                                    Mention two importanttant functions of thecell wall? | 
                            
| 
                                   Answer»  Answer: The cell wall is an integral component of the PLANT cell and it PERFORMS many essential functions. Following are some of the MAJOR cell wall functions observed: The plant cell wall provides definite shape, strength, rigidity. It also provides protection against MECHANICAL STRESS and physical shocks.  | 
                            |
| 2998. | 
                                    write the rich sources and functions and deficiency disease of vitamin E, vitamin D Vit B12 and Vit C | 
                            
| 
                                   Answer»  all GOOD foods are RICH in all Explanation: may be you LIKE my answer  | 
                            |
| 2999. | 
                                    What will happen when ovum released from ovary does gets fertilized | 
                            
                                   Answer» This is when a MATURE egg or ovum is released from one of the ovaries. The ovaries are the TWO female reproductive organs FOUND in the pelvis. If the egg is fertilized by a sperm as it travels down the fallopian tube, then pregnancy occurs. The fertilized egg ATTACHES to the lining of the uterus. | 
                            |
| 3000. | 
                                    Malaria is a vector borne disease true or false | 
                            
| 
                                   Answer»  TRUE is your answer MARK as BRAINLIEST  | 
                            |