This section includes 7 InterviewSolutions, each offering curated multiple-choice questions to sharpen your Current Affairs knowledge and support exam preparation. Choose a topic below to get started.
| 1. |
If A and B two events such that P(A)=0.2, P(B)=0.4 and `P(A cup B)=0.5`, then value of `P(A//B)` is ?A. 0.1B. 0.25C. 0.5D. 0.08 |
|
Answer» Correct Answer - B `0.25` |
|
| 2. |
If `|Z-4/Z|=2` then maximum value of `|Z|` is equal toA. 2B. 3C. 4D. 5 |
|
Answer» `|z-(4)/(z)|=2` `|z+((-4)/(z))| ge |z|-|(-4)/(z)|` `xge|z|-(4)/(|z|)rArr|z|2ge|z|^(2)-4` `|z|^(2)-2|z|-4 le 0 rArr |z| le (2+-sqrt(4+16))/(2)` `|z| le 1 +- sqrt(5) rArr |z| le sqrt(5)+1` |
|
| 3. |
∫x3 dx for x ∈ [a,b] = .....(a) (b3 - a3)/3 (b) (b4 - a4)/4(c) (b2 - a2)/2(d) 0 |
|
Answer» Answer is (b) (b4 - a4)/4 |
|
| 4. |
The solution of dy/dx = x/y is : |
|
Answer» Answer is (a) (y2/2) - (x2/2) = k |
|
| 5. |
The solution of the differential equation dy/dx = ex - y is : |
|
Answer» Answer is (c) ex - ey = k |
|
| 6. |
The equation of a parabola having its focus at S(2,0) and one extremity of its latus rectum as (2,2) isA. `y^(2)=4(3-x)`B. `y^(2)=4(1-x)`C. `y^(2)=4(1-x)`D. `y^(2)=8(3-x)` |
|
Answer» Clearly, the other extremity of the latus rectum is (2,-2). It axis is the x-axis. Corresponding value of `a=(2-0)/(2)=1` Hence, its vertex is (1,0) or (3,0). Thus, its equation is `y^(2)=4(x-1)` or `y^(2)=-4(x-3)`. |
|
| 7. |
The foot of the perpendicular form `(2,4,-1)` to the line `x +5 =(1)/(4) (y+3) = -(1)/(9) (z - 6)` isA. `(-4,1,-3)`B. `(4,-1,-3)`C. `(-4,-1,3)`D. `(-4,-1,3)` |
|
Answer» Correct Answer - A Given , `(x +5)/(1) = (y+3)/(4) = (z-6)/(-9) = lambda` Any point on the line `P(lambda - 5, 4lambda - 3, -9lambda + 6)` `therefore` Direction ratio of line PQ are. `(lambda - 5 -2,4lambda,-3-4, - 9lambda + 6+1)` ` = (lambda - 7, 4lambda - 7, - 9lambda + 7)` `therefore ` PQ is perpendicular to the given line `because 1(lambda - 7) + 4(4lambda - 7) - 9(-9lambda + 7) = 0` `rArr lambda - 7 + 16lambda - 28 + 81lambda - 63 = 0` `rArr " "lambda = 1` `because` The coordinate of foot of perpendicular are `(-4,1,-3)` |
|
| 8. |
The order of the differential equation dy/dx + 4y = 2x is :(a) 0(b) 1(c) 2(d) 3 |
|
Answer» Answer is (b) 1 |
|
| 9. |
The solution of the differential equation `(1+y^(2)) tan^(-1) x dx + y(1+x^(2)) dy = 0` isA. `log((tan^(-1)x)/(x)) + y(1+x^(2)) =0`B. `log ((tan^(-1)x)/(x)) + y(1+x^(2))= c`C. `log (1+x^(2)) + log (tan^(-1)y) + c`D. `(tan^(-1) x) (1+y^(2))+c=0` |
|
Answer» Correct Answer - B Given `(tan^(-1)x)/(1+x^(2)) dx + (y)/(1+y^(2)) dy = 0` integrating both sides , we get `rArr ((tan^(-1)x)^(2))/(2) +(1)/(2)log(1+y^(2)) = (C)/(2)` ` rArr (tan^(-1) x)^(2) + log (1+y^(2)) = c` |
|
| 10. |
The degree of the equation (d2y/dx2)3 - 4(dy/dx) = 2 is :(a) 0(b) 1(c) 2(d) 3 |
|
Answer» Answer is (d) 3 |
|
| 11. |
The point which does not lie in the half plane `2x+3y-12 le 0` isA. (1,2)B. (2,1)C. (2,3)D. (-3,2) |
|
Answer» Correct Answer - C `(2,3)` |
|
| 12. |
The position vector of the point (4,5,6) is : |
|
Answer» Answer is (a) vector(4i + 5j + 6k) |
|
| 13. |
The direction cosines of z-axis are :(a) (0,0,0) (b) (1,0,0) (c) (0,0,1) (d) (0,1,0) |
|
Answer» Answer is (c) (0,0,1) |
|
| 14. |
|vector(2i - 3j + k)| = (a) 14(b) √14(c) √3 (d) 2 |
|
Answer» Answer is (b) √14 |
|
| 15. |
If `sin^-1 x+sin^-1=(2pi)/3,` then `cos^-1 x cos^-1 y` is equal toA. `(2pi)/(3)`B. `(pi)/(3)`C. `(pi)/(2)`D. `pi` |
|
Answer» Correct Answer - B `(pi)/(3)` |
|
| 16. |
`int(dx)/(sqrt(9-25x^(2)))`A. `sin^(-1)((5x)/(3))+c`B. `(1)/(5)sin^(-1)((5x)/(3))+c`C. `(1)/(6)log ((3+5x)/(3-5x))+c`D. `(1)/(30)log ((3+5x)/(3-5x))+c` |
|
Answer» Correct Answer - B `(1)/(5) sin^(-1)((5x)/3)+c` |
|
| 17. |
If vector OA = vector(2i + 5j - 2k) and vector OB = vector(3i + 6j + 5k), then vector AB = |
|
Answer» Answer is (a) vector(i + j + 7k) |
|
| 18. |
vector(j x k) = (a) vector i(b) vector - i(c) zero vector (d) 1 |
|
Answer» Answer is (a) vector i |
|
| 19. |
An urn contains 6 balls of which two are red and four are black. Two balls are drawn at random. Probability that they are of the different colours isA. `(2)/(5)`B. `(1)/(15)`C. `(8)/(15)`D. `(4)/(15)` |
|
Answer» Correct Answer - C `(8)/(15)` |
|
| 20. |
lf vector a and vector b are mutually perpendicular then vector(a.b) = (a) 1(b) 0(c) 2(d) 3 |
|
Answer» Answer is (b) 0 |
|
| 21. |
lf vector a = vector(i + j + 2k), then the corresponding unit vector a in the direction of a = (d) None of these |
|
Answer» Answer is (b) vector(i + j + 2k)/√6 |
|
| 22. |
If vector(AO + OB) = vector(BO + OC), then A,B,C are(a) Coplanar(b) Collinear(c) Non-collinear(d) Non-coplanar |
|
Answer» Answer is (a) Coplanar & (b) Collinear |
|
| 23. |
The projection of the vector i - 2j + k on the vector 4i - 4j + 7k is(a) 19/8(b) 19/9(c) 19/11(d) 19/7 |
|
Answer» Answer is (b) 19/9 |
|
| 24. |
The class interval is the difference between: (a) Two extreme values (b) Two successive frequencies (c) Two successive upper limits (d) Two largest values |
|
Answer» (c) Two successive upper limits |
|
| 25. |
The number of classes depends upon: (a) Class marks (b) Frequency (c) Class interval (d) Class boundary |
|
Answer» (c) Class interval |
|
| 26. |
If the midpoints are 10, 15, 20, 25 and 30. The last class boundary of the distribution is: (a) 25-30 (b) 27.5-32.5 (c) 20-35 (d) 30-35 |
|
Answer» (b) 27.5----32.5 |
|
| 27. |
The class marks are given below: 10,12,14,16,18. The first class of the distribution is: (a) 9-12 (b) 10.5-12.5 (c) 9-11 (d) 10-12 |
|
Answer» Correct option is (c) 9----11 |
|
| 28. |
Width of interval h is equal to:(a) \(\frac{largest \,number - 20}{number \,of \,classes}\)(b) \(\frac{largest \,number +smallest\, number}{number \,of \,classes}\)(c) \(\frac{largest \,number +smallest\, number}{number \,of \,classes}\)(d) \(\frac{number \,of \,classes}{Range}\) |
|
Answer» (c) \(\frac{largest \,number +smallest\, number}{number \,of \,classes}\) |
|
| 29. |
On selling an article for Rs. 329, a dealer lost 6%. What will be the cost price of the article?1. Rs. 348.742. Rs. 310.373. Rs. 3504. Rs. 335 |
|
Answer» Correct Answer - Option 3 : Rs. 350 Given: Selling price = Rs. 329 Loss = 6% Formula used: C.P = S.P × [100/(100 – Loss%)] Calculation: Cost price = Rs. 329 × (100/94) ⇒ Rs. 350 ∴ The cost price of the article is Rs. 350 |
|
| 30. |
Name the three steps of PCR technique in proper sequence. |
| Answer» The three steps of PCR technique are heat denaturation. Annealing and polymerisation (extension). | |
| 31. |
The dealer marks the price of an article at Rs. 175. If he gives two successive discount of 8% each. Then, what will be the selling price?1. Rs. 134.152. Rs. 123.453. Rs. 148.124. Rs. 154.34 |
|
Answer» Correct Answer - Option 3 : Rs. 148.12 Given: Each discount: 8% Market price: Rs. 175 Formula used: Selling price = Market price (1 – D1%) (1 – D1%) Where D1 and D2 represents successive discounts. Calculation: S.P. = 175 (1 – 8%) (1 – 8%) ⇒ 148.12 Alternate method: Market price = Rs. 175 Price after first discount = 175 - 175 × 8% ⇒ Rs. 161 Price after second discount = 161 – 161 × 8% ⇒ Rs.148.12 So, selling price is Rs. 148.12 |
|
| 32. |
What are biodiversity hot spots? Name the biodiversity hot spots of India. |
|
Answer» These are regions with very high levels of species richness and endemism. They are the most threatened reservoir of biodiversity on earth. There are two Biodiversity hotspots in India 1. Western Ghats 2. Eastern Himalayas |
|
| 33. |
What is test cross? Mention the uses of test cross. |
|
Answer» When offspring with dominant phenotype, whose genotype is not known, is crossed with an individual who is homozygous recessive for the trait is known as test cross Use of Test Cross: The test cross is used to find the genotype of an organism. |
|
| 34. |
Distinguish between homologous and analogous organs. |
|
Answer» Homologous organs
Analogous organs
|
|
| 35. |
1. Day neutral plants do not need light to flower. 2. Short day plants require long nights to flower. 3. Both vernalization and florigen have the same function.4. Most plant indeed locomotory.5. Plant movement and locomotion are usually the same. 6. Plant roots are positively geotropic but negatively phototropic.7. Nictynastic movements are reversible movements.8. Aleurone layer in monocots stores starch in the seed.9. The coleorhiza in monocots performs the same function as the hypocotyl in dicots. |
|
Answer» 1. False 2. True 3. False 4. False 5. False 6. True 7. True 8. True 9. True |
|
| 36. |
What is genetics? |
|
Answer» Science which deals with the study of heridity and variations is called genetic. |
|
| 37. |
Give the common name of a plant on which Mendel performed its experiments. |
|
Answer» On pea plant Mendel performed its experiments. |
|
| 38. |
What is biofortification? Mention its importance. |
|
Answer» Breeding crops with higher levels of vitamins and minerals or higher protein and healthier fats is known as biofortification. The objective of bio fortification is to increase quality and improving nutritional status of the plants by improving 1. Protein content and quality 2. Oil content and quality 3. Vitamin content 4. Micronutrient and mineral content E.g. Vitamin A enriched carrots, spinach; pumpkin, Vitamin C enriched bitter gourd, calcium enriched spinach, protein enriched beans etc. |
|
| 39. |
What for did Mendel use the term factors and what are these factors called now? |
|
Answer» Mendel used the term factors for genes. |
|
| 40. |
What are genes? Where are the genes located? |
|
Answer» Genes is the unit of inheritance it is a part of the chromosome which controls the appearance of a set of heredity character gender are located on the chromosomes. |
|
| 41. |
What is asexual reproduction? Name the mode of asexual reproduction in the following cases. (a) Yeast (b) Amoeba (c) Penicillium (d) Sponges |
|
Answer» (a) Yeast – Budding (b) Amoeba – Binary fission (c) Penicillium – Sporulation (conidia) (d) Sponges – Gemmules (internal buds) |
|
| 42. |
Define evalution? Describe the contribution of landmark. |
|
Answer» Evalution is referred to as the changes acquired by a species or a certain population of a species gradually over a long period of time these changes should be heritable contribution of landmark. According to the theory of inheritance of acquired characters or Lamarkism, put forward by landmark. The use and disuse of an organ leads to acquiring change in the features of that organ. These change are also inherited by the offsprings the favorable variations caused due to use and tissue after a considerably long period of time result in evolution of a new species. |
|
| 43. |
2) Papaya plants exhibits xenogamy. Why ?3) What is amniocontesis?4) Define apomixis.5) What is frame shift mutation?6) Define central dogma. |
|
Answer» 2). Xenogamy is the type of pollination in which the transfer of pollen from one flower take place to the stigma of the flower on another plant. Papaya is a unisexual plant in which male and female flowers are present on different plants. Hence, the plant can exhibit xenogamy only. 3). Amniocentesis is a procedure in which amniotic fluid is removed from the uterus for testing or treatment. Amniotic fluid is the fluid that surrounds and protects a baby during pregnancy. This fluid contains fetal cells and various proteins. 4). Apomixis in flowering plants is defined as the asexual formation of a seed from the maternal tissues of the ovule, avoiding the processes of meiosis and fertilization, leading to embryo development. 5). A frameshift mutation is a genetic mutation caused by a deletion or insertion in a DNA sequence that shifts the way the sequence is read. A DNA sequence is a chain of many smaller molecules called nucleotides. 6). Central dogma is the process in which the genetic information flows from DNA to RNA, to make a functional product protein. |
|
| 44. |
What is Ichthyostegia? |
| Answer» Ichthyostegia is a missing link between fish and amphibia. | |
| 45. |
a. The image shown below is of a sacred grove found in India. Explain how has human involvement helped in the preservation of these biodiversity rich regions.b. Value of Z (regression coefficient) is considered for measuring the species richness of an area. If the value of Z is 0.7 for area A ,and 0.15 for area B, which area has higher species richness and a steeper slope? |
|
Answer» a. India’s history of religious and cultural traditions emphasized the protection of nature. In many cultures, tracts of forest are set aside, all the trees and wildlife within are venerated and given total protection. Sacred groves in many states are the last refuges for a large number of rare and threatened plants. b. Area A will have more species richness and a steeper slope. |
|
| 46. |
The image below depicts the result of gel electrophoresis.If the ladder represents sequence length upto 3000 base pairs (bp),a. Which of the bands (I - IV) correspond to 2500 bp and 100 bp respectively? b. Explain the basis of this kind of separation and also mention the significance of this process. |
|
Answer» a. Band III corresponds to 2500 base pairs, and Band IV corresponds to 100bp. b. The fragments will resolve according to their size. The shorter sequence fragments would move farthest from well as seen in Band IV (100 bp) which is lighter as compared to Band III which is heavier being 2500 base pairs. The significance of electrophoresis is to purify the DNA fragments for use in constructing recombinant DNA by joining them with cloning vectors. |
|
| 47. |
Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.a. What is the objective of this action? b. Explain how the gene of interest is introduced into a vector. c. You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity. d. A gene M was introduced into E.coli cloning vector PBR322 at BamH1 site. What will be its impact on the recombinant plamids? Give a possible way by which you could differentiate non recombinant to recombinant plasmids.ORGM crops especially Bt crops are known to have higher resistance to pest attacks. To substantiate this an experimental study was conducted in 4 different farmlands growing Bt and non Bt-Cotton crops. The farm lands had the same dimensions, fertility and were under similar climatic conditions. The histogram below shows the usage of pesticides on Bt crops and non-Bt crops in these farm lands.a. Which of the above 4 farm lands has successfully applied the concepts of Biotechnology to show better management practices and use of agrochemicals? If you had to cultivate, which crop would you prefer (Bt or Non- Bt) and why? b. Cotton Bollworms were introduced in another experimental study on the above farm lands where in no pesticide was used. Explain what effect would a Bt and Non Bt crop have on the pest. |
|
Answer» a. The two different DNA molecules will have compatible ends to recombine. b. Restriction enzyme cuts the DNA of the vector and then ligates the gene of interest into the DNA of the vector. c. 2 fragments 5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAG 5’.3’GCATTACAGGA 5’ d. BamH1 site will affect tetracycline antibiotic resistance gene, hence the recombinant plasmids will lose tetracycline resistance due to inactivation of the resistance gene. Recombinants can be selected from non recombinants by plating into a medium containing tetracycline, as the recombinants will not grow in the medium because the tetracycline resistance gene is cut. OR a. Farm Land II. Bt crop. Because the use of pesticides is highly reduced for Bt crop // Decrease of pesticide used is also more significant for Bt crop. b. In Bt cotton a cry gene has been introduce from bacterium Bacillus thuringiensis (Bt) which causes synthesis of a toxic protein. This protein becomes active in the alkaline gut of bollworm feeding on cotton, punching holes in the lining causing death of the insect. However; a Non Bt crop will have no effect on the cotton bollworm/ the yield of cotton will decrease / non Bt will succumb to pest attack. |
|
| 48. |
a) heat stable, dialyzable, non-protein organic molecules b)soluble, colloidal, protein molecules c)structural analogue of enzymes d)different forms of enzymes |
|
Answer» a) heat stable, dialyzable, non-protein organic molecules |
|
| 49. |
Which of the following is a diamagnetic ion: (Atomic numbers of Sc, V, Mn and Cu are 21, 23, 25 and 29 respectively)a) V2+ b) Sc3+ c) Cu2+ d) Mn3+ |
|
Answer» The correct answer is: B |
|
| 50. |
The first stage of hair growth cycle is 1. Anagen 2. Catagen 3. Telogen |
|
Answer» The first stage of hair growth cycle is Anagen. |
|